Virus:Article Title: Organization and development of bilateral somatosensory feedback projections in mice
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit pAb anti-cFos Synaptic Systems 226003; RRID: AB_2231974 Chicken anti-green fluorescent protein (GFP) Aves labs GFP-1020; RRID: AB_10000240 Rabbit anti-red fluorescent protein (RFP) Rockland 600-401-379; RRID: AB_2209751 Goat anti-hRobo3 R&D systems AF3076; RRID: AB_2181865 Bacterial and virus strains pAAV-hSyn-EGFP Addgene 50465-AAV1; RRID: Addgene_50465 ssAAV-9/2-hSyn1-chI-dFRT-EGFP(rev)-dFRTWPRE-hGHp(A) Viral Vector facility - ETH Zurich V335-9 ssAAV-retro/2-hSyn1-chI-mCherry_2A_FLPoWPRE-SV40p(A) Viral Vector facility - ETH Zurich V173-retro Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (recombinant), Alexa Fluor TM 647 conjugate (CTB 647) Thermo Fisher Invitrogen C34778 Cholera toxin subunit B (recombinant), Alexa Fluor TM 555 conjugate (CTB 555) Thermo Fisher Invitrogen C34776 Experimental models: Organisms/strains CART-cre mice (B6;129S-Cartpttm1.1(cre)Hze/J) Jackson Laboratories Stock 028533; RRID:IMSR_JAX:028533 CamKIIa-cre mice (B6.Cg-TgC amkIIa-cre)T291Stl/J) Jackson Laboratories Stock 005359: RRID:IMSR_JAX:005359 Krox20:Cre;Robo3lox/lox mice Mouse Clinical Institute–Institut Clinique de la Souris, Illkirch, France RjOrl:SWISS mice Janvier Laboratories RRID:IMSR_Rj:SWISS Software and algorithms Fiji Schneider et al., 2012 49 https://imagej.nih.gov/ij/ Imaris Oxford Instruments https://imaris.oxinst.com/ Syglass IstoVisio https://www.syglass.io/ ITKsnap Yushkevich P.A. et al., 2006 50 http://www.itksnap.org TubeMap Kirst et al. 51 https://github.com/ClearAnatomics/ClearMap TrailMap Friedmann et al. 18 https://github.com/albert597/TRAILMAP Deeptrace Gongwer M.W. et al., 2023 52 https://github.com/DeNardoLab/DeepTraCE GraphPad GraphPad software https://www.graphpad.com/scientificsoftware/ prism/ e1 iScience 28, 112725, June 20, 2025 Mice of the strain RjOrl:SWISS (from Janvier Laboratories) were used for the developmental time course and deprivation experiments. ..
Article Title: Astrocyte-secreted neurocan controls inhibitory synapse formation and function.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Actin Sigma-Aldrich Cat# A5441; RRID: AB_476744 Bassoon Enzo/Assay Designs Cat# ADI-VAM-PS003F; RRID: AB_11181058 Ctip2 Abcam Cat# Ab18465; RRID: AB_2064130 GAD-67 Millipore MAB5406; RRID:AB_2278725 Gephyrin Synaptic Systems Cat# 147 002; RRID:AB_2619838 Gephyrin Synaptic Systems Cat# 147 011; RRID:AB_887717 GFAP Sigma Cat# G3893; RRID:AB_477010 GFP Aves labs GFP-1020; RRID:AB_10000240 HA Roche 11867423001; RRID:AB_390918 HA Aves Labs Cat# ET-HA100; RRID:AB_2313511 Homer1 Synaptic systems Cat# 160 002; RRID: AB_2120990 Homer1 Synaptic systems Cat#160011; RRID: AB_2120992 L1 (ASCS4) DSHB Cat# ascs4; RRID:AB_528349 LHX2 Millipore Cat# ABE1402; RRID: AB_2722523 MAP2 Abcam Cat# ab32454; RRID:AB_1001650 NCAN C-Terminal Invitrogen Cat# PA5-79718; RRID: AB_2746833 NCAN N-Terminal R&D Systems Cat#AF5800; RRID: AB_2149717 NeuN (A60) Millipore Cat# MAB377; RRID:AB_2298772 NeuN Millipore Cat# ABN78; RRID:AB_10807945 Olig2 (211F1.1) Millipore Cat# MABN50; RRID:AB_10807410 Parvalbumin Abcam Cat# ab11427; RRID:AB_298032 PSD-95 Life Technologies Cat# 51–6900; RRID:AB_87705 Somatostatin Bma Biomedicals Ag Cat# T-4103; RRID:AB_518614 Somatostatin Millipore Cat# MAB354; RRID: AB_2255365 Sox9 Millipore Cat# AB5535; RRID:AB_2239761 Synaptotagmin-2 Synaptic Systems Cat# 105 225; RRID: AB_2744654 Synaptotagmin-2 Synaptic Systems Cat# 105 223; RRID: AB_10894084 TBR1 Abcam Cat#31940; RRID: AB_2200219 VGAT Synaptic Systems Cat# 131 004; RRID:AB_887873 VGluT1 Millipore Cat# AB5905; RRID:AB_2301751 WFA Vector Laboratories Cat# B-1355 Bacterial and virus strains One Shot STBL3 Thermo Fisher Cat# C737303 AAV PhP.eB This paper N/A Chemicals, peptides, and recombinant proteins AraC Sigma Cat# C1768 B27 GIBCO Cat# 17504044 B27 Plus GIBCO Cat# A3582801 BDNF PeproTech Cat# 450-02 Carboxypeptidase E R&D Cat# 3587-ZN CNTF PeproTech Cat# 450–13 Clusterin R&D Cat# 2937-HS (Continued on next page) e1 Neuron 112, 1–19.e1–e10, May 15, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER DMEM GIBCO Cat# 11960 DPBS GIBCO Cat# 14287 Dystroglycan R&D Cat# 6868-DG Fetal Bovine Serum Thermo Fisher Cat# 10-437-028 Forskolin Sigma Cat# F6886 Glycerol Acros Organics Cat# AC158920010 L-glutamine GIBCO Cat# 25030-081 Hydrocortisone Sigma Cat# H0888-5G Insulin Sigma Cat# I1882 Neurobasal GIBCO Cat# 21103049 Neurobasal Plus GIBCO Cat# A3582901 Neurobasal minus Phenol Red GIBCO Cat# 12348017 Neurocan Full-Length This paper N/A Neurocan ELS This paper N/A Neurocan IL This paper N/A Odyssey Blocking Buffer LI-COR Biosciences Cat# 927–40000 Opti-MEM Thermo Fisher Cat# 11058021 Paraformaldehyde Electron microscopy Sciences Cat# 19210 Pen/Strep GIBCO Cat# 15140 PhosSTOP Roche Cat# 4906845001 Poly-D-lysine Sigma Cat# P6407 Protease Inhibitor Cocktail Roche Cat# 4693132001 RIPA Buffer Sigma Cat# R0278 Sodium Pyruvate GIBCO Cat# 11360-070 DyLight 594 Streptavidin Vector Laboratories Cat# SA-5594 TGFb1 R&D Cat# 7666-MB Tissue-Tek O.C.T.
Recombinant:Article Title: Organization and development of bilateral somatosensory feedback projections in mice
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit pAb anti-cFos Synaptic Systems 226003; RRID: AB_2231974 Chicken anti-green fluorescent protein (GFP) Aves labs GFP-1020; RRID: AB_10000240 Rabbit anti-red fluorescent protein (RFP) Rockland 600-401-379; RRID: AB_2209751 Goat anti-hRobo3 R&D systems AF3076; RRID: AB_2181865 Bacterial and virus strains pAAV-hSyn-EGFP Addgene 50465-AAV1; RRID: Addgene_50465 ssAAV-9/2-hSyn1-chI-dFRT-EGFP(rev)-dFRTWPRE-hGHp(A) Viral Vector facility - ETH Zurich V335-9 ssAAV-retro/2-hSyn1-chI-mCherry_2A_FLPoWPRE-SV40p(A) Viral Vector facility - ETH Zurich V173-retro Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (recombinant), Alexa Fluor TM 647 conjugate (CTB 647) Thermo Fisher Invitrogen C34778 Cholera toxin subunit B (recombinant), Alexa Fluor TM 555 conjugate (CTB 555) Thermo Fisher Invitrogen C34776 Experimental models: Organisms/strains CART-cre mice (B6;129S-Cartpttm1.1(cre)Hze/J) Jackson Laboratories Stock 028533; RRID:IMSR_JAX:028533 CamKIIa-cre mice (B6.Cg-TgC amkIIa-cre)T291Stl/J) Jackson Laboratories Stock 005359: RRID:IMSR_JAX:005359 Krox20:Cre;Robo3lox/lox mice Mouse Clinical Institute–Institut Clinique de la Souris, Illkirch, France RjOrl:SWISS mice Janvier Laboratories RRID:IMSR_Rj:SWISS Software and algorithms Fiji Schneider et al., 2012 49 https://imagej.nih.gov/ij/ Imaris Oxford Instruments https://imaris.oxinst.com/ Syglass IstoVisio https://www.syglass.io/ ITKsnap Yushkevich P.A. et al., 2006 50 http://www.itksnap.org TubeMap Kirst et al. 51 https://github.com/ClearAnatomics/ClearMap TrailMap Friedmann et al. 18 https://github.com/albert597/TRAILMAP Deeptrace Gongwer M.W. et al., 2023 52 https://github.com/DeNardoLab/DeepTraCE GraphPad GraphPad software https://www.graphpad.com/scientificsoftware/ prism/ e1 iScience 28, 112725, June 20, 2025 Mice of the strain RjOrl:SWISS (from Janvier Laboratories) were used for the developmental time course and deprivation experiments. ..
Article Title: Astrocyte-secreted neurocan controls inhibitory synapse formation and function.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Actin Sigma-Aldrich Cat# A5441; RRID: AB_476744 Bassoon Enzo/Assay Designs Cat# ADI-VAM-PS003F; RRID: AB_11181058 Ctip2 Abcam Cat# Ab18465; RRID: AB_2064130 GAD-67 Millipore MAB5406; RRID:AB_2278725 Gephyrin Synaptic Systems Cat# 147 002; RRID:AB_2619838 Gephyrin Synaptic Systems Cat# 147 011; RRID:AB_887717 GFAP Sigma Cat# G3893; RRID:AB_477010 GFP Aves labs GFP-1020; RRID:AB_10000240 HA Roche 11867423001; RRID:AB_390918 HA Aves Labs Cat# ET-HA100; RRID:AB_2313511 Homer1 Synaptic systems Cat# 160 002; RRID: AB_2120990 Homer1 Synaptic systems Cat#160011; RRID: AB_2120992 L1 (ASCS4) DSHB Cat# ascs4; RRID:AB_528349 LHX2 Millipore Cat# ABE1402; RRID: AB_2722523 MAP2 Abcam Cat# ab32454; RRID:AB_1001650 NCAN C-Terminal Invitrogen Cat# PA5-79718; RRID: AB_2746833 NCAN N-Terminal R&D Systems Cat#AF5800; RRID: AB_2149717 NeuN (A60) Millipore Cat# MAB377; RRID:AB_2298772 NeuN Millipore Cat# ABN78; RRID:AB_10807945 Olig2 (211F1.1) Millipore Cat# MABN50; RRID:AB_10807410 Parvalbumin Abcam Cat# ab11427; RRID:AB_298032 PSD-95 Life Technologies Cat# 51–6900; RRID:AB_87705 Somatostatin Bma Biomedicals Ag Cat# T-4103; RRID:AB_518614 Somatostatin Millipore Cat# MAB354; RRID: AB_2255365 Sox9 Millipore Cat# AB5535; RRID:AB_2239761 Synaptotagmin-2 Synaptic Systems Cat# 105 225; RRID: AB_2744654 Synaptotagmin-2 Synaptic Systems Cat# 105 223; RRID: AB_10894084 TBR1 Abcam Cat#31940; RRID: AB_2200219 VGAT Synaptic Systems Cat# 131 004; RRID:AB_887873 VGluT1 Millipore Cat# AB5905; RRID:AB_2301751 WFA Vector Laboratories Cat# B-1355 Bacterial and virus strains One Shot STBL3 Thermo Fisher Cat# C737303 AAV PhP.eB This paper N/A Chemicals, peptides, and recombinant proteins AraC Sigma Cat# C1768 B27 GIBCO Cat# 17504044 B27 Plus GIBCO Cat# A3582801 BDNF PeproTech Cat# 450-02 Carboxypeptidase E R&D Cat# 3587-ZN CNTF PeproTech Cat# 450–13 Clusterin R&D Cat# 2937-HS (Continued on next page) e1 Neuron 112, 1–19.e1–e10, May 15, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER DMEM GIBCO Cat# 11960 DPBS GIBCO Cat# 14287 Dystroglycan R&D Cat# 6868-DG Fetal Bovine Serum Thermo Fisher Cat# 10-437-028 Forskolin Sigma Cat# F6886 Glycerol Acros Organics Cat# AC158920010 L-glutamine GIBCO Cat# 25030-081 Hydrocortisone Sigma Cat# H0888-5G Insulin Sigma Cat# I1882 Neurobasal GIBCO Cat# 21103049 Neurobasal Plus GIBCO Cat# A3582901 Neurobasal minus Phenol Red GIBCO Cat# 12348017 Neurocan Full-Length This paper N/A Neurocan ELS This paper N/A Neurocan IL This paper N/A Odyssey Blocking Buffer LI-COR Biosciences Cat# 927–40000 Opti-MEM Thermo Fisher Cat# 11058021 Paraformaldehyde Electron microscopy Sciences Cat# 19210 Pen/Strep GIBCO Cat# 15140 PhosSTOP Roche Cat# 4906845001 Poly-D-lysine Sigma Cat# P6407 Protease Inhibitor Cocktail Roche Cat# 4693132001 RIPA Buffer Sigma Cat# R0278 Sodium Pyruvate GIBCO Cat# 11360-070 DyLight 594 Streptavidin Vector Laboratories Cat# SA-5594 TGFb1 R&D Cat# 7666-MB Tissue-Tek O.C.T.
Software:Article Title: Organization and development of bilateral somatosensory feedback projections in mice
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit pAb anti-cFos Synaptic Systems 226003; RRID: AB_2231974 Chicken anti-green fluorescent protein (GFP) Aves labs GFP-1020; RRID: AB_10000240 Rabbit anti-red fluorescent protein (RFP) Rockland 600-401-379; RRID: AB_2209751 Goat anti-hRobo3 R&D systems AF3076; RRID: AB_2181865 Bacterial and virus strains pAAV-hSyn-EGFP Addgene 50465-AAV1; RRID: Addgene_50465 ssAAV-9/2-hSyn1-chI-dFRT-EGFP(rev)-dFRTWPRE-hGHp(A) Viral Vector facility - ETH Zurich V335-9 ssAAV-retro/2-hSyn1-chI-mCherry_2A_FLPoWPRE-SV40p(A) Viral Vector facility - ETH Zurich V173-retro Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (recombinant), Alexa Fluor TM 647 conjugate (CTB 647) Thermo Fisher Invitrogen C34778 Cholera toxin subunit B (recombinant), Alexa Fluor TM 555 conjugate (CTB 555) Thermo Fisher Invitrogen C34776 Experimental models: Organisms/strains CART-cre mice (B6;129S-Cartpttm1.1(cre)Hze/J) Jackson Laboratories Stock 028533; RRID:IMSR_JAX:028533 CamKIIa-cre mice (B6.Cg-TgC amkIIa-cre)T291Stl/J) Jackson Laboratories Stock 005359: RRID:IMSR_JAX:005359 Krox20:Cre;Robo3lox/lox mice Mouse Clinical Institute–Institut Clinique de la Souris, Illkirch, France RjOrl:SWISS mice Janvier Laboratories RRID:IMSR_Rj:SWISS Software and algorithms Fiji Schneider et al., 2012 49 https://imagej.nih.gov/ij/ Imaris Oxford Instruments https://imaris.oxinst.com/ Syglass IstoVisio https://www.syglass.io/ ITKsnap Yushkevich P.A. et al., 2006 50 http://www.itksnap.org TubeMap Kirst et al. 51 https://github.com/ClearAnatomics/ClearMap TrailMap Friedmann et al. 18 https://github.com/albert597/TRAILMAP Deeptrace Gongwer M.W. et al., 2023 52 https://github.com/DeNardoLab/DeepTraCE GraphPad GraphPad software https://www.graphpad.com/scientificsoftware/ prism/ e1 iScience 28, 112725, June 20, 2025 Mice of the strain RjOrl:SWISS (from Janvier Laboratories) were used for the developmental time course and deprivation experiments. ..
Mouse Assay:Article Title: Organization and development of bilateral somatosensory feedback projections in mice
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit pAb anti-cFos Synaptic Systems 226003; RRID: AB_2231974 Chicken anti-green fluorescent protein (GFP) Aves labs GFP-1020; RRID: AB_10000240 Rabbit anti-red fluorescent protein (RFP) Rockland 600-401-379; RRID: AB_2209751 Goat anti-hRobo3 R&D systems AF3076; RRID: AB_2181865 Bacterial and virus strains pAAV-hSyn-EGFP Addgene 50465-AAV1; RRID: Addgene_50465 ssAAV-9/2-hSyn1-chI-dFRT-EGFP(rev)-dFRTWPRE-hGHp(A) Viral Vector facility - ETH Zurich V335-9 ssAAV-retro/2-hSyn1-chI-mCherry_2A_FLPoWPRE-SV40p(A) Viral Vector facility - ETH Zurich V173-retro Chemicals, peptides, and recombinant proteins Cholera toxin subunit B (recombinant), Alexa Fluor TM 647 conjugate (CTB 647) Thermo Fisher Invitrogen C34778 Cholera toxin subunit B (recombinant), Alexa Fluor TM 555 conjugate (CTB 555) Thermo Fisher Invitrogen C34776 Experimental models: Organisms/strains CART-cre mice (B6;129S-Cartpttm1.1(cre)Hze/J) Jackson Laboratories Stock 028533; RRID:IMSR_JAX:028533 CamKIIa-cre mice (B6.Cg-TgC amkIIa-cre)T291Stl/J) Jackson Laboratories Stock 005359: RRID:IMSR_JAX:005359 Krox20:Cre;Robo3lox/lox mice Mouse Clinical Institute–Institut Clinique de la Souris, Illkirch, France RjOrl:SWISS mice Janvier Laboratories RRID:IMSR_Rj:SWISS Software and algorithms Fiji Schneider et al., 2012 49 https://imagej.nih.gov/ij/ Imaris Oxford Instruments https://imaris.oxinst.com/ Syglass IstoVisio https://www.syglass.io/ ITKsnap Yushkevich P.A. et al., 2006 50 http://www.itksnap.org TubeMap Kirst et al. 51 https://github.com/ClearAnatomics/ClearMap TrailMap Friedmann et al. 18 https://github.com/albert597/TRAILMAP Deeptrace Gongwer M.W. et al., 2023 52 https://github.com/DeNardoLab/DeepTraCE GraphPad GraphPad software https://www.graphpad.com/scientificsoftware/ prism/ e1 iScience 28, 112725, June 20, 2025 Mice of the strain RjOrl:SWISS (from Janvier Laboratories) were used for the developmental time course and deprivation experiments. ..
Bioprocessing:Article Title: Astrocyte-secreted neurocan controls inhibitory synapse formation and function.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Actin Sigma-Aldrich Cat# A5441; RRID: AB_476744 Bassoon Enzo/Assay Designs Cat# ADI-VAM-PS003F; RRID: AB_11181058 Ctip2 Abcam Cat# Ab18465; RRID: AB_2064130 GAD-67 Millipore MAB5406; RRID:AB_2278725 Gephyrin Synaptic Systems Cat# 147 002; RRID:AB_2619838 Gephyrin Synaptic Systems Cat# 147 011; RRID:AB_887717 GFAP Sigma Cat# G3893; RRID:AB_477010 GFP Aves labs GFP-1020; RRID:AB_10000240 HA Roche 11867423001; RRID:AB_390918 HA Aves Labs Cat# ET-HA100; RRID:AB_2313511 Homer1 Synaptic systems Cat# 160 002; RRID: AB_2120990 Homer1 Synaptic systems Cat#160011; RRID: AB_2120992 L1 (ASCS4) DSHB Cat# ascs4; RRID:AB_528349 LHX2 Millipore Cat# ABE1402; RRID: AB_2722523 MAP2 Abcam Cat# ab32454; RRID:AB_1001650 NCAN C-Terminal Invitrogen Cat# PA5-79718; RRID: AB_2746833 NCAN N-Terminal R&D Systems Cat#AF5800; RRID: AB_2149717 NeuN (A60) Millipore Cat# MAB377; RRID:AB_2298772 NeuN Millipore Cat# ABN78; RRID:AB_10807945 Olig2 (211F1.1) Millipore Cat# MABN50; RRID:AB_10807410 Parvalbumin Abcam Cat# ab11427; RRID:AB_298032 PSD-95 Life Technologies Cat# 51–6900; RRID:AB_87705 Somatostatin Bma Biomedicals Ag Cat# T-4103; RRID:AB_518614 Somatostatin Millipore Cat# MAB354; RRID: AB_2255365 Sox9 Millipore Cat# AB5535; RRID:AB_2239761 Synaptotagmin-2 Synaptic Systems Cat# 105 225; RRID: AB_2744654 Synaptotagmin-2 Synaptic Systems Cat# 105 223; RRID: AB_10894084 TBR1 Abcam Cat#31940; RRID: AB_2200219 VGAT Synaptic Systems Cat# 131 004; RRID:AB_887873 VGluT1 Millipore Cat# AB5905; RRID:AB_2301751 WFA Vector Laboratories Cat# B-1355 Bacterial and virus strains One Shot STBL3 Thermo Fisher Cat# C737303 AAV PhP.eB This paper N/A Chemicals, peptides, and recombinant proteins AraC Sigma Cat# C1768 B27 GIBCO Cat# 17504044 B27 Plus GIBCO Cat# A3582801 BDNF PeproTech Cat# 450-02 Carboxypeptidase E R&D Cat# 3587-ZN CNTF PeproTech Cat# 450–13 Clusterin R&D Cat# 2937-HS (Continued on next page) e1 Neuron 112, 1–19.e1–e10, May 15, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER DMEM GIBCO Cat# 11960 DPBS GIBCO Cat# 14287 Dystroglycan R&D Cat# 6868-DG Fetal Bovine Serum Thermo Fisher Cat# 10-437-028 Forskolin Sigma Cat# F6886 Glycerol Acros Organics Cat# AC158920010 L-glutamine GIBCO Cat# 25030-081 Hydrocortisone Sigma Cat# H0888-5G Insulin Sigma Cat# I1882 Neurobasal GIBCO Cat# 21103049 Neurobasal Plus GIBCO Cat# A3582901 Neurobasal minus Phenol Red GIBCO Cat# 12348017 Neurocan Full-Length This paper N/A Neurocan ELS This paper N/A Neurocan IL This paper N/A Odyssey Blocking Buffer LI-COR Biosciences Cat# 927–40000 Opti-MEM Thermo Fisher Cat# 11058021 Paraformaldehyde Electron microscopy Sciences Cat# 19210 Pen/Strep GIBCO Cat# 15140 PhosSTOP Roche Cat# 4906845001 Poly-D-lysine Sigma Cat# P6407 Protease Inhibitor Cocktail Roche Cat# 4693132001 RIPA Buffer Sigma Cat# R0278 Sodium Pyruvate GIBCO Cat# 11360-070 DyLight 594 Streptavidin Vector Laboratories Cat# SA-5594 TGFb1 R&D Cat# 7666-MB Tissue-Tek O.C.T.
other:Article Title: Distinct waves of ovarian follicles contribute to mouse oocyte production
Article Snippet: Anti- EGFP (Chicken) Aves labs GFP- 1020 1:300 Anti- DDX4 (Rabbit) Abcam ab13840 1:300 Anti- MSY2 (Mouse) Abcam sc- 393840 1:100 Anti- tdTomato (Goat) Origene Tech AB8181- 200 1:300 Anti- HSD3B1 (Mouse) Santa Cruz sc- 515120 1:100 Anti- CYP17A1 (Rabbit) Cell Signaling Technology 94004T 1:100 Anti- PLIN1 (Rabbit) Abcam ab3526 1:100 DAPI Sigma D9542- 10mg 0.5 μg/ml Alexa Fluor 488 AffiniPure Donkey Anti- Chicken IgY (IgG) (H+L) Jackson ImmunoResearch 703- 545- 155 1:300 Continued on next page Yin and Spradling. eLife 2025;14:RP107352.
Western Blot:Article Title: Methods for detecting and inhibiting brain metastasis
Article Snippet: For CEMIP quantification, the ratio between the CEMIP and ACTB band intensities for each sample was measured using ImageJ software. .. TABLE 2 Antibody List Antibody/Protein Product Antibody Application recognized Vendor reference dilution Immunoblot CEMIP Novus biologicals 4575.00.02 1:5000 HSP70 System EXOAB- 1:1000 Biosciences Hsp70A-1 Syntenin-1 Santa Cruz sc-100336 1:200 biotechnology CD81 Santa Cruz sc-166029 1:1000 biotechnology ACTB [unconjugated] Cell Signaling 4967L 1:1000 ACTB [peroxidase- Sigma A3854 1:20000 conjugated] Mouse/Rabbit Whole IgG Jackson 1:5000 [peroxidase-conjugated] ImmunoResearch Laboratories Immunofluorescence GFP Aves labs GFP-1020 1:200 mCherry abcam ab205402 1:200 Collagen IV abcam ab6586 1:500 PECAM-1/CD31 Santa Cruz sc-18916 1:50 biotechnology Glut-1 abcam ab40084 1:100 Iba-1 Wako 019-19741 1:200 GFAP abcam ab7260 1:500 NeuN Millipore ABN90 1:500 Ki-67 abcam ab66155 1:500 Mouse/Rat/Chicken/Rabbit Life technologies A11001, 1:500 IgG [fluorochrome- A11008, conjugated] A11036, A11039, A11077, A21244, A21247, A27040 Mouse IgG [fluorochrome- Vector CI-2000 1:500 conjugated] laboratories Immunohistochemistry CEMIP abcam ab76849 1:100 FACS CD45 EBioscience 56-0451-82 1:100 CD31 BD Biosciences 561073 1:40 CD11b BD Biosciences 550993 1:200 CD49d Biolegend 103618 1:100 Primer List Primer Application name Primer sequence Notes CEMIP CEMIP CGTACCAACGGGCCCCTCCG (SEQ knockout gRNA ID NO: 114) KO1 GCGGCTTGGACCATAGCGGA CEMIP (SEQ ID NO: 115) gRNA KO2 CEMIP CEMIP 5′- with 5′ overexpression forward ACGTACTCGAGCACCATGGGAGCTGCTGGGAGGCA- PspXI 3′ (SEQ ID NO: 116) restriction CEMIP 5′-ACGTGCTAGCCTACAACTTCTTCTTCTTCAC-3′ site reverse (SEQ ID NO: 117) with 3′ NheI restriction site Exosome OptiPrepTM density gradient. .. To prepare the discontinuous iodixanol gradient, 40% (w/v), 20% (w/v), 10% (w/v) and 5% (w/v) iodixanol solutions were made by diluting OptiPrepTM (60% (w/v) aqueous iodixanol from Sigma) with 0.25 M sucrose/10 mM Tris, pH 7.5.
Immunofluorescence:Article Title: Methods for detecting and inhibiting brain metastasis
Article Snippet: For CEMIP quantification, the ratio between the CEMIP and ACTB band intensities for each sample was measured using ImageJ software. .. TABLE 2 Antibody List Antibody/Protein Product Antibody Application recognized Vendor reference dilution Immunoblot CEMIP Novus biologicals 4575.00.02 1:5000 HSP70 System EXOAB- 1:1000 Biosciences Hsp70A-1 Syntenin-1 Santa Cruz sc-100336 1:200 biotechnology CD81 Santa Cruz sc-166029 1:1000 biotechnology ACTB [unconjugated] Cell Signaling 4967L 1:1000 ACTB [peroxidase- Sigma A3854 1:20000 conjugated] Mouse/Rabbit Whole IgG Jackson 1:5000 [peroxidase-conjugated] ImmunoResearch Laboratories Immunofluorescence GFP Aves labs GFP-1020 1:200 mCherry abcam ab205402 1:200 Collagen IV abcam ab6586 1:500 PECAM-1/CD31 Santa Cruz sc-18916 1:50 biotechnology Glut-1 abcam ab40084 1:100 Iba-1 Wako 019-19741 1:200 GFAP abcam ab7260 1:500 NeuN Millipore ABN90 1:500 Ki-67 abcam ab66155 1:500 Mouse/Rat/Chicken/Rabbit Life technologies A11001, 1:500 IgG [fluorochrome- A11008, conjugated] A11036, A11039, A11077, A21244, A21247, A27040 Mouse IgG [fluorochrome- Vector CI-2000 1:500 conjugated] laboratories Immunohistochemistry CEMIP abcam ab76849 1:100 FACS CD45 EBioscience 56-0451-82 1:100 CD31 BD Biosciences 561073 1:40 CD11b BD Biosciences 550993 1:200 CD49d Biolegend 103618 1:100 Primer List Primer Application name Primer sequence Notes CEMIP CEMIP CGTACCAACGGGCCCCTCCG (SEQ knockout gRNA ID NO: 114) KO1 GCGGCTTGGACCATAGCGGA CEMIP (SEQ ID NO: 115) gRNA KO2 CEMIP CEMIP 5′- with 5′ overexpression forward ACGTACTCGAGCACCATGGGAGCTGCTGGGAGGCA- PspXI 3′ (SEQ ID NO: 116) restriction CEMIP 5′-ACGTGCTAGCCTACAACTTCTTCTTCTTCAC-3′ site reverse (SEQ ID NO: 117) with 3′ NheI restriction site Exosome OptiPrepTM density gradient. .. To prepare the discontinuous iodixanol gradient, 40% (w/v), 20% (w/v), 10% (w/v) and 5% (w/v) iodixanol solutions were made by diluting OptiPrepTM (60% (w/v) aqueous iodixanol from Sigma) with 0.25 M sucrose/10 mM Tris, pH 7.5.
Immunohistochemistry:Article Title: Methods for detecting and inhibiting brain metastasis
Article Snippet: For CEMIP quantification, the ratio between the CEMIP and ACTB band intensities for each sample was measured using ImageJ software. .. TABLE 2 Antibody List Antibody/Protein Product Antibody Application recognized Vendor reference dilution Immunoblot CEMIP Novus biologicals 4575.00.02 1:5000 HSP70 System EXOAB- 1:1000 Biosciences Hsp70A-1 Syntenin-1 Santa Cruz sc-100336 1:200 biotechnology CD81 Santa Cruz sc-166029 1:1000 biotechnology ACTB [unconjugated] Cell Signaling 4967L 1:1000 ACTB [peroxidase- Sigma A3854 1:20000 conjugated] Mouse/Rabbit Whole IgG Jackson 1:5000 [peroxidase-conjugated] ImmunoResearch Laboratories Immunofluorescence GFP Aves labs GFP-1020 1:200 mCherry abcam ab205402 1:200 Collagen IV abcam ab6586 1:500 PECAM-1/CD31 Santa Cruz sc-18916 1:50 biotechnology Glut-1 abcam ab40084 1:100 Iba-1 Wako 019-19741 1:200 GFAP abcam ab7260 1:500 NeuN Millipore ABN90 1:500 Ki-67 abcam ab66155 1:500 Mouse/Rat/Chicken/Rabbit Life technologies A11001, 1:500 IgG [fluorochrome- A11008, conjugated] A11036, A11039, A11077, A21244, A21247, A27040 Mouse IgG [fluorochrome- Vector CI-2000 1:500 conjugated] laboratories Immunohistochemistry CEMIP abcam ab76849 1:100 FACS CD45 EBioscience 56-0451-82 1:100 CD31 BD Biosciences 561073 1:40 CD11b BD Biosciences 550993 1:200 CD49d Biolegend 103618 1:100 Primer List Primer Application name Primer sequence Notes CEMIP CEMIP CGTACCAACGGGCCCCTCCG (SEQ knockout gRNA ID NO: 114) KO1 GCGGCTTGGACCATAGCGGA CEMIP (SEQ ID NO: 115) gRNA KO2 CEMIP CEMIP 5′- with 5′ overexpression forward ACGTACTCGAGCACCATGGGAGCTGCTGGGAGGCA- PspXI 3′ (SEQ ID NO: 116) restriction CEMIP 5′-ACGTGCTAGCCTACAACTTCTTCTTCTTCAC-3′ site reverse (SEQ ID NO: 117) with 3′ NheI restriction site Exosome OptiPrepTM density gradient. .. To prepare the discontinuous iodixanol gradient, 40% (w/v), 20% (w/v), 10% (w/v) and 5% (w/v) iodixanol solutions were made by diluting OptiPrepTM (60% (w/v) aqueous iodixanol from Sigma) with 0.25 M sucrose/10 mM Tris, pH 7.5.
FACS:Article Title: Methods for detecting and inhibiting brain metastasis
Article Snippet: For CEMIP quantification, the ratio between the CEMIP and ACTB band intensities for each sample was measured using ImageJ software. .. TABLE 2 Antibody List Antibody/Protein Product Antibody Application recognized Vendor reference dilution Immunoblot CEMIP Novus biologicals 4575.00.02 1:5000 HSP70 System EXOAB- 1:1000 Biosciences Hsp70A-1 Syntenin-1 Santa Cruz sc-100336 1:200 biotechnology CD81 Santa Cruz sc-166029 1:1000 biotechnology ACTB [unconjugated] Cell Signaling 4967L 1:1000 ACTB [peroxidase- Sigma A3854 1:20000 conjugated] Mouse/Rabbit Whole IgG Jackson 1:5000 [peroxidase-conjugated] ImmunoResearch Laboratories Immunofluorescence GFP Aves labs GFP-1020 1:200 mCherry abcam ab205402 1:200 Collagen IV abcam ab6586 1:500 PECAM-1/CD31 Santa Cruz sc-18916 1:50 biotechnology Glut-1 abcam ab40084 1:100 Iba-1 Wako 019-19741 1:200 GFAP abcam ab7260 1:500 NeuN Millipore ABN90 1:500 Ki-67 abcam ab66155 1:500 Mouse/Rat/Chicken/Rabbit Life technologies A11001, 1:500 IgG [fluorochrome- A11008, conjugated] A11036, A11039, A11077, A21244, A21247, A27040 Mouse IgG [fluorochrome- Vector CI-2000 1:500 conjugated] laboratories Immunohistochemistry CEMIP abcam ab76849 1:100 FACS CD45 EBioscience 56-0451-82 1:100 CD31 BD Biosciences 561073 1:40 CD11b BD Biosciences 550993 1:200 CD49d Biolegend 103618 1:100 Primer List Primer Application name Primer sequence Notes CEMIP CEMIP CGTACCAACGGGCCCCTCCG (SEQ knockout gRNA ID NO: 114) KO1 GCGGCTTGGACCATAGCGGA CEMIP (SEQ ID NO: 115) gRNA KO2 CEMIP CEMIP 5′- with 5′ overexpression forward ACGTACTCGAGCACCATGGGAGCTGCTGGGAGGCA- PspXI 3′ (SEQ ID NO: 116) restriction CEMIP 5′-ACGTGCTAGCCTACAACTTCTTCTTCTTCAC-3′ site reverse (SEQ ID NO: 117) with 3′ NheI restriction site Exosome OptiPrepTM density gradient. .. To prepare the discontinuous iodixanol gradient, 40% (w/v), 20% (w/v), 10% (w/v) and 5% (w/v) iodixanol solutions were made by diluting OptiPrepTM (60% (w/v) aqueous iodixanol from Sigma) with 0.25 M sucrose/10 mM Tris, pH 7.5.
Sequencing:Article Title: Methods for detecting and inhibiting brain metastasis
Article Snippet: For CEMIP quantification, the ratio between the CEMIP and ACTB band intensities for each sample was measured using ImageJ software. .. TABLE 2 Antibody List Antibody/Protein Product Antibody Application recognized Vendor reference dilution Immunoblot CEMIP Novus biologicals 4575.00.02 1:5000 HSP70 System EXOAB- 1:1000 Biosciences Hsp70A-1 Syntenin-1 Santa Cruz sc-100336 1:200 biotechnology CD81 Santa Cruz sc-166029 1:1000 biotechnology ACTB [unconjugated] Cell Signaling 4967L 1:1000 ACTB [peroxidase- Sigma A3854 1:20000 conjugated] Mouse/Rabbit Whole IgG Jackson 1:5000 [peroxidase-conjugated] ImmunoResearch Laboratories Immunofluorescence GFP Aves labs GFP-1020 1:200 mCherry abcam ab205402 1:200 Collagen IV abcam ab6586 1:500 PECAM-1/CD31 Santa Cruz sc-18916 1:50 biotechnology Glut-1 abcam ab40084 1:100 Iba-1 Wako 019-19741 1:200 GFAP abcam ab7260 1:500 NeuN Millipore ABN90 1:500 Ki-67 abcam ab66155 1:500 Mouse/Rat/Chicken/Rabbit Life technologies A11001, 1:500 IgG [fluorochrome- A11008, conjugated] A11036, A11039, A11077, A21244, A21247, A27040 Mouse IgG [fluorochrome- Vector CI-2000 1:500 conjugated] laboratories Immunohistochemistry CEMIP abcam ab76849 1:100 FACS CD45 EBioscience 56-0451-82 1:100 CD31 BD Biosciences 561073 1:40 CD11b BD Biosciences 550993 1:200 CD49d Biolegend 103618 1:100 Primer List Primer Application name Primer sequence Notes CEMIP CEMIP CGTACCAACGGGCCCCTCCG (SEQ knockout gRNA ID NO: 114) KO1 GCGGCTTGGACCATAGCGGA CEMIP (SEQ ID NO: 115) gRNA KO2 CEMIP CEMIP 5′- with 5′ overexpression forward ACGTACTCGAGCACCATGGGAGCTGCTGGGAGGCA- PspXI 3′ (SEQ ID NO: 116) restriction CEMIP 5′-ACGTGCTAGCCTACAACTTCTTCTTCTTCAC-3′ site reverse (SEQ ID NO: 117) with 3′ NheI restriction site Exosome OptiPrepTM density gradient. .. To prepare the discontinuous iodixanol gradient, 40% (w/v), 20% (w/v), 10% (w/v) and 5% (w/v) iodixanol solutions were made by diluting OptiPrepTM (60% (w/v) aqueous iodixanol from Sigma) with 0.25 M sucrose/10 mM Tris, pH 7.5.
Knock-Out:Article Title: Methods for detecting and inhibiting brain metastasis
Article Snippet: For CEMIP quantification, the ratio between the CEMIP and ACTB band intensities for each sample was measured using ImageJ software. .. TABLE 2 Antibody List Antibody/Protein Product Antibody Application recognized Vendor reference dilution Immunoblot CEMIP Novus biologicals 4575.00.02 1:5000 HSP70 System EXOAB- 1:1000 Biosciences Hsp70A-1 Syntenin-1 Santa Cruz sc-100336 1:200 biotechnology CD81 Santa Cruz sc-166029 1:1000 biotechnology ACTB [unconjugated] Cell Signaling 4967L 1:1000 ACTB [peroxidase- Sigma A3854 1:20000 conjugated] Mouse/Rabbit Whole IgG Jackson 1:5000 [peroxidase-conjugated] ImmunoResearch Laboratories Immunofluorescence GFP Aves labs GFP-1020 1:200 mCherry abcam ab205402 1:200 Collagen IV abcam ab6586 1:500 PECAM-1/CD31 Santa Cruz sc-18916 1:50 biotechnology Glut-1 abcam ab40084 1:100 Iba-1 Wako 019-19741 1:200 GFAP abcam ab7260 1:500 NeuN Millipore ABN90 1:500 Ki-67 abcam ab66155 1:500 Mouse/Rat/Chicken/Rabbit Life technologies A11001, 1:500 IgG [fluorochrome- A11008, conjugated] A11036, A11039, A11077, A21244, A21247, A27040 Mouse IgG [fluorochrome- Vector CI-2000 1:500 conjugated] laboratories Immunohistochemistry CEMIP abcam ab76849 1:100 FACS CD45 EBioscience 56-0451-82 1:100 CD31 BD Biosciences 561073 1:40 CD11b BD Biosciences 550993 1:200 CD49d Biolegend 103618 1:100 Primer List Primer Application name Primer sequence Notes CEMIP CEMIP CGTACCAACGGGCCCCTCCG (SEQ knockout gRNA ID NO: 114) KO1 GCGGCTTGGACCATAGCGGA CEMIP (SEQ ID NO: 115) gRNA KO2 CEMIP CEMIP 5′- with 5′ overexpression forward ACGTACTCGAGCACCATGGGAGCTGCTGGGAGGCA- PspXI 3′ (SEQ ID NO: 116) restriction CEMIP 5′-ACGTGCTAGCCTACAACTTCTTCTTCTTCAC-3′ site reverse (SEQ ID NO: 117) with 3′ NheI restriction site Exosome OptiPrepTM density gradient. .. To prepare the discontinuous iodixanol gradient, 40% (w/v), 20% (w/v), 10% (w/v) and 5% (w/v) iodixanol solutions were made by diluting OptiPrepTM (60% (w/v) aqueous iodixanol from Sigma) with 0.25 M sucrose/10 mM Tris, pH 7.5.
Over Expression:Article Title: Methods for detecting and inhibiting brain metastasis
Article Snippet: For CEMIP quantification, the ratio between the CEMIP and ACTB band intensities for each sample was measured using ImageJ software. .. TABLE 2 Antibody List Antibody/Protein Product Antibody Application recognized Vendor reference dilution Immunoblot CEMIP Novus biologicals 4575.00.02 1:5000 HSP70 System EXOAB- 1:1000 Biosciences Hsp70A-1 Syntenin-1 Santa Cruz sc-100336 1:200 biotechnology CD81 Santa Cruz sc-166029 1:1000 biotechnology ACTB [unconjugated] Cell Signaling 4967L 1:1000 ACTB [peroxidase- Sigma A3854 1:20000 conjugated] Mouse/Rabbit Whole IgG Jackson 1:5000 [peroxidase-conjugated] ImmunoResearch Laboratories Immunofluorescence GFP Aves labs GFP-1020 1:200 mCherry abcam ab205402 1:200 Collagen IV abcam ab6586 1:500 PECAM-1/CD31 Santa Cruz sc-18916 1:50 biotechnology Glut-1 abcam ab40084 1:100 Iba-1 Wako 019-19741 1:200 GFAP abcam ab7260 1:500 NeuN Millipore ABN90 1:500 Ki-67 abcam ab66155 1:500 Mouse/Rat/Chicken/Rabbit Life technologies A11001, 1:500 IgG [fluorochrome- A11008, conjugated] A11036, A11039, A11077, A21244, A21247, A27040 Mouse IgG [fluorochrome- Vector CI-2000 1:500 conjugated] laboratories Immunohistochemistry CEMIP abcam ab76849 1:100 FACS CD45 EBioscience 56-0451-82 1:100 CD31 BD Biosciences 561073 1:40 CD11b BD Biosciences 550993 1:200 CD49d Biolegend 103618 1:100 Primer List Primer Application name Primer sequence Notes CEMIP CEMIP CGTACCAACGGGCCCCTCCG (SEQ knockout gRNA ID NO: 114) KO1 GCGGCTTGGACCATAGCGGA CEMIP (SEQ ID NO: 115) gRNA KO2 CEMIP CEMIP 5′- with 5′ overexpression forward ACGTACTCGAGCACCATGGGAGCTGCTGGGAGGCA- PspXI 3′ (SEQ ID NO: 116) restriction CEMIP 5′-ACGTGCTAGCCTACAACTTCTTCTTCTTCAC-3′ site reverse (SEQ ID NO: 117) with 3′ NheI restriction site Exosome OptiPrepTM density gradient. .. To prepare the discontinuous iodixanol gradient, 40% (w/v), 20% (w/v), 10% (w/v) and 5% (w/v) iodixanol solutions were made by diluting OptiPrepTM (60% (w/v) aqueous iodixanol from Sigma) with 0.25 M sucrose/10 mM Tris, pH 7.5.
|
AvesLabs is a verified supplier 
AvesLabs manufactures this product 